Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
CCACGTGTTGAGATCATTGCTACAATGAAAAAGAAGGGTGAGAAGAGATGTCTGAATCCAGAATCGAAGGCCATCAAGAATTTACTGAAAGCAGTTAGCAAGGAAAGGTCTAAAAGATCTCCTTAAAACCAGAGGGGAGCAAAATCGATGCAGTGCTTCCAAGGATGGACCACACAGAGGCTGCCTCTCCCATCACTTCCCTACATGGAGTATATGTCAAGCCATAATTGTTCTTAGTTTGCAGTTACACTAAAAGGTGACCAATGATGGTCACCAAATCAGCTGCTACTACTCCTGTAGGAAGGTTAATGTTCATCATCCTAAGCTATTCAGTAATAACTCTACCCTGGCACTATAATGTAAGCTCTACTGAGGTGCTATGTTCTTAGTGGATGTTCTGACCCTGCTTCAAATATTTCCCTCACCTTTCCCATCTTCCA
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Yi Fu et al.
International immunopharmacology, 75, 105783-105783 (2019-08-04)
Myrothecine A, characterized from the extracts of myrothecium roridum strain IFB-E012, isolated as endophytic fungi found in the traditional Chinese medicinal plant Artemisia annua. Here we investigated its roles on anti-tumor and immune regulation in vitro. Dendritic cells (DCs) are
Xiuming Wu et al.
Molecular and cellular endocrinology, 512, 110866-110866 (2020-05-18)
Although 70% of estrogen receptor (ER)-positive breast cancer patients can benefit from tamoxifen therapy, the rapid development of tamoxifen resistance hampers the treatment advantage. In this investigation, we found that the serum level of CXCL10 in breast cancer patients was
Katrina K Au et al.
Gynecologic oncology, 145(3), 436-445 (2017-03-21)
We recently established that high STAT1 expression and associated T helper type I tumour immune microenvironment (TME) are prognostic and chemotherapy response predictive biomarkers in high-grade serous ovarian cancer (HGSC). STAT1 induced chemokine CXCL10 is key to the recruitment of
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU002541-20UG | 04061828668038 |
| EHU002541-50UG | 04061828443369 |