Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
ATCCTGAAAGAAGCGGATCAAAAAGAACAGTTTTCCCAAGGATCTCCAAGCAACTGTCTGGAAACTTCTTTGGCAGAGATATTTCCTTTAGGAAAAAATCACAGCTCTAAAGTTAATTCAGACAGCGGTATTCCAGGATTAGCAGCCAGTGTCTTAGTTGTGAGTCACGGTGCTTACATGAGAAGTCTGTTTGATTATTTTCTGACTGACCTTAAGTGTTCCTTACCAGCCACTCTGAGCAGATCTGAACTTATGTCAGTCACTCCCAATACAGGGATGAGTCTCTTTATCATAAACTTTGAGGAAGGAAGAGAAGTTAAACCAACGGTTCAGTGTATTTGTATGAACCTACAGGATCATCTAAATGGACTGACTGAAACTCGCTAAGGTTAAATCTGCATCAAAATCTAACCATTTTGAGCCTCTGAAGGGAGTG
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... TIGAR(57103), C12orf5(57103)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Jian Ma et al.
Veterinary research, 45, 82-82 (2014-08-12)
The Chinese attenuated equine infectious anemia virus (EIAV) vaccine has successfully protected millions of equine animals from EIA disease in China. Given that the induction of immune protection results from the interactions between viruses and hosts, a better understanding of
Wen-feng Gou et al.
BMC cancer, 14, 477-477 (2014-07-06)
RhoC is a small G protein/GTPase and involved in tumor mobility, invasion and metastasis. Previously, up-regulated RhoC expression is found to play an important role in ovarian carcinogenesis and subsequent progression by modulating proliferation, apoptosis, migration and invasion. We transfected
Dao Chao Huang et al.
Endocrinology, 155(10), 3739-3749 (2014-07-23)
The role of PTHrP in the highly metastatic human melanoma disease is not known. This study investigates the mechanisms of action of this secreted factor through homozygous inactivation of the Pthrp gene in A375 human melanoma cells. In vitro, Pthrp-ablated
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU006891-20UG | 04061828677719 |
| EHU006891-50UG | 04061828453627 |