Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
AGCAGCCAAACTATGGGCTAGCCATTGAGGTGACTCACCTCCATCAGACTCGGACCCACCAGGGCCAGCATGTCAGGATTAGCCGATCGTTACCTCAAGGGAGTGGGAATTGGGCCCAGCTCCGGCCCCTCCTGGTCACCTTTGGCCATGATGGCCGGGGCCATGCCTTGACCCGACGCCGGAGGGCCAAGCGTAGCCCTAAGCATCACTCACAGCGGGCCAGGAAGAAGAATAAGAACTGCCGGCGCCACTCGCTCTATGTGGACTTCAGCGATGTGGGCTGGAATGACTGGATTGTGGCCCCACCAGGCTACCAGGCCTTCTACTGCCATGGGGACTGCCCCTTTCCACTGGCTGACCACCTCAACTCAACCAACCATGCCATTGTGCAGACCCTGGTCAATTCTGTCAATTCCAGTATCCCCAAAGCC
Ensembl | human accession no.
shipped in
ambient
storage temp.
−20°C
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Janice Siu Chong Wong et al.
Experimental eye research, 181, 185-189 (2019-02-06)
Periorbital adipose tissue expansion is a key pathological change in thyroid associated orbitopathy (TAO). Bone morphogenic protein 4 (BMP4) is instrumental in adipogenesis. We compared site-specific BMP4 expression and its effect on adipogenesis using donor-matched adipose tissue-derived stromal cells (ADSC)
Thomas Helbing et al.
Inflammation, 40(6), 1862-1874 (2017-07-30)
Leukocyte recruitment is a fundamental event in the response of the innate immune system to injury. This process is promoted in part by the opening of endothelial cell adherens junctions that allows leukocyte extravasation through gaps between adjacent endothelial cells.
Xiaoqing Zhang et al.
Cell death discovery, 7(1), 51-51 (2021-03-17)
Alzheimer's disease (AD) is a chronic progressive degenerative disease of the nervous system. Its pathogenesis is complex and is related to the abnormal expression of the amyloid β (Aβ), APP, and Tau proteins. Evidence has demonstrated that bone morphogenetic protein
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU011461-50UG | 04061828447886 |
| EHU011461-20UG | 04061828673568 |