Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
GACCCCAATGGCTACATGATGATGTCCCCCAGCGGTGGCTGCTCTCCTGACATTGGAGGTGGCCCCAGCAGCAGCAGCAGCAGCAGCAACGCCGTCCCTTCCGGGACCAGCTATGGAAAGCTGTGGACAAACGGGGTAGGGGGCCACCACTCTCATGTCTTGCCTCACCCCAAACCCCCAGTGGAGAGCAGCGGTGGTAAGCTCTTACCTTGCACAGGTGACTACATGAACATGTCACCAGTGGGGGACTCCAACACCAGCAGCCCCTCCGACTGCTACTACGGCCCTGAGGACCCCCAGCACAAGCCAGTCCTCTCCTACTACTCATTGCCAAGATCCTTTAAGCACACCCAGCGCCCCGGGGAGCCGGAGGAGGGTGCCCGGCATCAGCACCTCCGCCTTTCCACTAGCTCTGGTCGCCTTC
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Y Chen et al.
European review for medical and pharmacological sciences, 23(18), 7989-7999 (2019-10-11)
The important role of microRNA-1271 (miR-1271) has been identified in human diseases and cancers. However, the biological function of miR-1271 remains ambiguous in papillary thyroid carcinoma (PTC). Therefore, the specific role of miR-1271 was investigated in PTC. The expressions of
Yongxin Luan et al.
International journal of clinical and experimental pathology, 8(9), 10345-10354 (2015-12-01)
MicroRNA (miR-126) was reported to be downregulated and to act as a tumor suppressor in cancers of the lung, cervix, bladder, breast, liver and prostate. However, the precise roles and underling mechanisms of miR-126 in glioma remain largely unknown. This
Peng Wang et al.
Technology in cancer research & treatment, 16(6), 1102-1112 (2018-01-16)
Thyroid cancer is a common endocrine gland malignancy which exhibited rapid increased incidence worldwide in recent decades. This study was aimed to investigate the role of long noncoding RNA H19 in thyroid cancer. Long noncoding RNA H19 was overexpressed or
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU020331-20UG | 04061828575060 |
| EHU020331-50UG | 04061828340309 |