Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
ACTGAGGACAACGAGGGTGTCCTGCTCACTGAGAAACTCAAGCCAGTGGATTATGAGTACCGAGAAGAAGTCCACTGGGCCACGCACCAGCTCCGCCTGGGCAGAGGCTCCTTCGGAGAGGTGCACAGGATGGAGGACAAGCAGACTGGCTTCCAGTGCGCTGTCAAAAAGGTGCGGCTGGAAGTATTTCGGGCAGAGGAGCTGATGGCATGTGCAGGATTGACCTCACCCAGAATTGTCCCTTTGTATGGAGCTGTGAGAGAAGGGCCTTGGGTCAACATCTTCATGGAGCTGCTGGAAGGTGGCTCCCTGGGCCAGCTGGTCAAGGAGCAGGGCTGTCTCCCAGAGGACCGGGCCCTGTACTACCTGGGCCAGGCCCTGGAGGGTCTGGAATACCTCCACTCACGAAGGATTCTGCA
Ensembl | human accession no.
shipped in
ambient
storage temp.
−20°C
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Miles C Duncan et al.
PloS one, 12(2), e0171406-e0171406 (2017-02-07)
Infection of human cells with Yersinia pseudotuberculosis expressing a functional type III secretion system (T3SS) leads to activation of host NF-κB. We show that the Yersinia T3SS activates distinct NF-κB pathways dependent upon bacterial subcellular localization. We found that wildtype
Kislay Parvatiyar et al.
Nature communications, 9(1), 2770-2770 (2018-07-19)
Detection of viral genomes by the innate immune system elicits an antiviral gene program mediated by type I interferons (IFNs). While viral RNA and DNA species induce IFN via separate pathways, the mechanisms by which these pathways are differentially modulated
Paulina Kucharzewska et al.
Journal of cell science, 132(7) (2019-03-07)
NF-κB-inducing kinase (NIK; also known as MAP3K14) is a central regulator of non-canonical NF-κB signaling in response to stimulation of TNF receptor superfamily members, such as the lymphotoxin-β receptor (LTβR), and is implicated in pathological angiogenesis associated with chronic inflammation
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU024531-50UG | 04061831371284 |
| EHU024531-20UG | 04061831349832 |