Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
GCTCCTCCTGGATACACAGCCCCTCCGATGCAGGGCTGCCCCCGGGAACCGTCACTCATTTCGGCAGCTACAATGTTTCTCGAGCAGCTGGCAATTTCTCCTCTCCAGACGGTACCACCGATGACCCTCTGGGAGGTCATACCGTCTGGCAAGTGGTCTTCATCGCTTTCTTAACGGGCATCCTGGCCTTGGTGACCATCATCGGCAACATCCTGGTAATTGTGTCATTTAAGGTCAACAAGCAGCTGAAGACGGTCAACAACTACTTCCTCTTAAGCCTGGCCTGTGCCGATCTGATTATCGGGGTCATTTCAATGAATCTGTTTACGACCTACATCATCATGAATCGATGGGCCTTAGGGAACTTGGCCTGTGACCTCTGGCTTGCCATTGACTACGTAGCCAGCAATGCCTCTGT
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Lulu Farhana et al.
Stem cell research & therapy, 7(1), 181-181 (2016-12-03)
Although the unconjugated secondary bile acids, specifically deoxycholic acid (DCA) and lithocholic acid (LCA), are considered to be risk factors for colorectal cancer, the precise mechanism(s) by which they regulate carcinogenesis is poorly understood. We hypothesize that the cytotoxic bile
Zhenhua Shang et al.
Neurourology and urodynamics, 38(2), 615-624 (2018-12-15)
To investigate the effects of injecting RNA interference (RNAi) lentiviruses targeting the muscarinic 3 (M3 ) receptor gene into the bladder wall on bladder activity in rats with spinal cord injury (SCI). Four M3 RNAi lentiviruses were constructed and used
Mahmoud Mona et al.
International journal of molecular sciences, 20(3) (2019-02-15)
Sjögren's syndrome (SjS) is an autoimmune disease that destroys the salivary glands and results in severe dry mouth. Mesenchymal stem cell (MSC) transplantation has been recently proposed as a promising therapy for restoring cells in multiple degenerative diseases. We have
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU027151-20UG | 04061828576487 |
| EHU027151-50UG | 04061828341023 |