Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
TGGCTGACAGTAGTCGCAAGGAAATTCTCCATTTTCCTAAGGGTGGGGGCTATAGTGTCCTTATTCGAGAGGGACTTACCTGTCCGGTGGGCATAGCCCTAACTCCTAAGGGGCAGCTGCTGGTCTTGGACTGTTGGGATCATTGCATCAAGATCTACAGCTACCATCTGAGAAGATATTCCACCCCATAGGGGATGAGAAATTATCAGTTTCTTCTGCTCCCAAGCCAACTTCCCTTCCCTTAGTTCTTGGTTGTTAGTGGCACATGCAGAATAGACTCAGCCTATGTCCTGATTCCAGCTGGGTAGTTCTAGAACTTCAGAAGCTCCATCTTTTAATGTTTTTATTTGTTATGTCCCCCTCCCCGCTTCCCACCTAAATTTAGAGCTTTAAAAGATGCACTGCCCAAATAGGAC
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Hao Cui et al.
Cellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacology, 43(2), 801-811 (2017-09-28)
Epithelial cells play important roles as a critical barrier in protecting the cornea from microbial pathogens infection. In this study, we were aiming to investigate the role of E3 ubiquitin ligase tripartite motif protein 32 (TRIM32) in corneal epithelial cells
Maria Angeliki S Pavlou et al.
Molecular neurobiology, 54(6), 4257-4270 (2016-06-25)
Alpha-synuclein is an abundant neuronal protein which has been associated with physiological processes like synaptic function, neurogenesis, and neuronal differentiation but also with pathological neurodegeneration. Indeed, alpha-synuclein (snca) is one of the major genes implicated in Parkinson's disease (PD). However
Sarah Gilbertson et al.
eLife, 7 (2018-10-04)
Alterations in global mRNA decay broadly impact multiple stages of gene expression, although signals that connect these processes are incompletely defined. Here, we used tandem mass tag labeling coupled with mass spectrometry to reveal that changing the mRNA decay landscape
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU029161-20UG | 04061831350456 |
| EHU029161-50UG | 04061828342945 |