Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
GCAAAACCCAAGGGTAACAAGGATTACCATCTACAGACATGCTGTGGGAGTCTGGCTTATGCAGCACCTGAGTTAATACAAGGCAAATCATATCTTGGATCAGAGGCAGATGTTTGGAGCATGGGCATACTGTTATATGTTCTTATGTGTGGATTTCTACCATTTGATGATGATAATGTAATGGCTTTATACAAGAAGATTATGAGAGGAAAATATGATGTTCCCAAGTGGCTCTCTCCCAGTAGCATTCTGCTTCTTCAACAAATGCTGCAGGTGGACCCAAAGAAACGGATTTCTATGAAAAATCTATTGAACCATCCCTGGATCATGCAAGATTACAACTATCCTGTTGAGTGGCAAAGCAAGAATCCTTTTATTCACCTCGATGATGATTGCGTAACAGAACTTTCTGTACATCACAGAAACAACAGGCAAACAATGGAGGATTTAATTTCACTGTGGCAGTATGATCACCTCACGG
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Ke Wang et al.
Oncology reports, 39(6), 2777-2786 (2018-04-06)
Retinoblastoma (Rb) is the most frequent primary intraocular tumor usually diagnosed in infants and children, and current therapy for such disease is still limited. Corosolic acid (CA), an ursane-type pentacyclic triterpene, has been assessed as a promising anticancer agent with little impact
Gang Li et al.
Oncology letters, 15(6), 9934-9940 (2018-05-29)
Maternal embryonic leucine zipper kinase (MELK) is an important regulator in tumorigenesis of human breast cancer, and if silenced leads to programmed cell death in specific breast cancer cell lines, including MDA-MB-231 cells. In the present study, RNA interference, proliferation
Antonio Cigliano et al.
Medicina (Kaunas, Lithuania), 56(1) (2019-12-22)
Background and Objectives: Intrahepatic cholangiocarcinoma (iCCA) is a pernicious tumor characterized by a dismal outcome and scarce therapeutic options. To substantially improve the prognosis of iCCA patients, a better understanding of the molecular mechanisms responsible for development and progression of
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU030401-20UG | 04061828579211 |
| EHU030401-50UG | 04061831371550 |