Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
CACTCCCTGTGAAGCTCTCCAGCATCATCGAGGTCCCATCAGGTGGGGAAAGATGCTGTTCCAGGCGCACACTAGTCTACAAGGCCAGAGCTTTCTGGAAGGGGGCACCCTTGCCCTGTTGGATGAATAGGCACCTCTGGAAGAGCCAACTGTGTGAGATGGTGCAGCCCAGTGGTGGCCCGGCAGCAGATCAGGACGTACTGGGCGAAGAGTCTCCTCTGGGGAAGCCAGCCATGCTGCACCTGCCTTCAGAACAGGGCGCTCCTGAGACCCTCCAGCGCTGCCTGGAGGAGAATCAAGAGCTCCGAGATGCCATCCGGCAGAGCAACCAGATTCTGCGGGAGCGCTGCGAGGAGCTTCTGCATTTCCAAGCCAGCCAGAGGGAGGAGAAGGAGTTCCTCATGTGCAAGTTCCAGGAGGCCAGGAAACTGGTGGAGAGACTCGGCCTGGAGAAGCTCGATCTGAAGAGGCAGAAGG
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Jérôme Bouchet et al.
Journal of immunology (Baltimore, Md. : 1950), 198(7), 2967-2978 (2017-02-27)
The role of endosomes in receptor signal transduction is a long-standing question, which remains largely unanswered. The T cell Ag receptor and various components of its proximal signaling machinery are associated with distinct endosomal compartments, but how endosomal traffic affects
Sona Hubackova et al.
Aging, 4(12), 932-951 (2013-02-07)
Many cancers arise at sites of infection and inflammation. Cellular senescence, a permanent state of cell cycle arrest that provides a barrier against tumorigenesis, is accompanied by elevated proinflammatory cytokines such as IL1, IL6, IL8 and TNFα. Here we demonstrate
CtIP and MRN promote non-homologous end-joining of etoposide-induced DNA double-strand breaks in G1.
Verena Quennet et al.
Nucleic acids research, 39(6), 2144-2152 (2010-11-20)
Topoisomerases class II (topoII) cleave and re-ligate the DNA double helix to allow the passage of an intact DNA strand through it. Chemotherapeutic drugs such as etoposide target topoII, interfere with the normal enzymatic cleavage/re-ligation reaction and create a DNA
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU032271-20UG | 04061828580828 |
| EHU032271-50UG | 04061828345908 |