Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
CCAAGGCAAGAAGAACATCCCGCGGATCACGAGTGACCGTCTCCTTATCAAGGGAGGCAGAATCGTCAATGATGATCAGTCCTTTTATGCTGATATTTACATGGAAGATGGCTTAATAAAACAAATTGGAGACAATCTGATTGTTCCTGGAGGAGTGAAGACCATTGAAGCCAATGGGAAGATGGTGATCCCTGGAGGCATCGATGTCCATACTCACTTCCAGATGCCATATAAGGGAATGACCACAGTAGATGACTTCTTCCAAGGGACAAAGGCGGCCTTAGCAGGTGGCACCACCATGATCATTGACCATGTGGTGCCTGAGCCTGAGTCCAGCCTGACTGAGGCCTATGAGAAATGGAGAGAGTGGGCTGATGGGAAGAGTTGCTGTGACTATGCCCTGCATGT
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Ke Li et al.
Oncotarget, 6(12), 10030-10044 (2015-04-19)
Prostate cancer is the most commonly diagnosed non-cutaneous cancer and one of the leading causes of cancer death for North American men. Whereas localized prostate cancer can be cured, there is currently no cure for metastatic prostate cancer. Here we
Xin Gao et al.
The Prostate, 78(9), 682-690 (2018-03-31)
Metastasis is the major cause of cancer-specific death in patients with prostate cancer (PCa). We previously reported that collapsing response mediator protein-4 (CRMP4) is a PCa metastasis-suppressor gene and the hypermethylation in CRMP4 promoter is responsible for the transcription repression
Hisaharu Oya et al.
Journal of gastroenterology, 50(5), 590-600 (2014-09-01)
Patients with hepatocellular carcinoma (HCC) may relapse after curative resection. Sensitive biomarkers for HCC are required to enhance disease management. Dihydropyrimidinase-like 3 (DPYSL3) suppresses cell proliferation and tumorigenicity of certain malignancies; however, its role in HCC is unknown. The expression
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU040071-20UG | 04061828534852 |
| EHU040071-50UG | 04061828299683 |