Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
TGGCTGCCATCCTTTACTTCTACCTGCTCTTCCCCAACTCCCTGAGCCTGAGTGAGCGTGTGGCCATCATCAAAGGCACGTATGAGCCTGACGAGGACTGGGAGGAGCAGCGGGAAGAGCGGAAGAAGACCATGGAGCTGACCACCCGCTGACCAGTGTCAGGCAGGGGCCAGCCCCTCAGCCCCTGAGCCAAGGGGGAAAAGAAGAAAAAGTACCTAACACAAGCTTCCTTTTTGCACAACCGGTCCTCTTGGCTGAGGAGGAGGAGCTGGTCACCCTGGCTGCACAGTTAGAGAGGGGAGAAGGAACCCATGATGGGACTCCTGGGGTAGGGGCCAGGGGCTGGGGTCTGCTGGGGACAGGTCTCTCTGGGACAGACCTCAGAGATTGTGAATGCAGTGCCA
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Chen Chen et al.
Molecular carcinogenesis, 56(12), 2692-2705 (2017-08-24)
Epithelial-mesenchymal transition (EMT) has emerged as an important determinant role in colorectal cancer (CRC) metastasis. It has been reported that aquaporin 5 (AQP5) is closely linked to CRC metastasis. However, the effect of AQP5 on the EMT process of CRC
Michihiro Kudou et al.
International journal of oncology, 50(5), 1857-1867 (2017-03-31)
Previous studies described that the expression of aquaporin 5 (AQP5) was altered in tumors of various organs. AQP5 is attracting attention as a new cancer therapeutic target. In the present study, heat shock-induced changes in AQP5 expression were evaluated by
Xueqing Li et al.
OncoTargets and therapy, 11, 3359-3368 (2018-06-21)
Based on the functionality of AQP-5 characterized in various physiological processes, our study aimed to investigate the effect of AQP-5 silencing by siRNA interference on chemosensitivity of breast cancer cells. The expression levels of AQP-5 mRNA in different experimental groups
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU046331-20UG | 04061831342789 |
| EHU046331-50UG | 04061828319688 |