Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
ACCTCGACACCACAGACACAGGCTACTTCCAGTGCGTGGCAACAAACGGCAAGGAGGTGGTTTCTTCCACTGGAGTCTTGTTTGTCAAGTTTGGCCCCCCTCCCACTGCAAGTCCAGGATACTCAGATGAGTATGAAGAAGATGGATTCTGTCAGCCATACAGAGGGATTGCATGTGCAAGATTTATTGGCAACCGCACCGTCTATATGGAGTCTTTGCACATGCAAGGGGAAATAGAAAATCAGATCACAGCTGCCTTCACTATGATTGGCACTTCCAGTCACTTATCTGATAAGTGTTCTCAGTTCGCCATTCCTTCCCTGTGCCACTATGCCTTCCCGTACTGCGATGAAACTTCATCCGTCCCAAAGCCCCGTGACTTGTGTCGCGATGAATGTGAAAT
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Fernanda Faião-Flores et al.
Clinical cancer research : an official journal of the American Association for Cancer Research, 25(18), 5686-5701 (2019-06-23)
The clinical use of MEK inhibitors in uveal melanoma is limited by the rapid acquisition of resistance. This study has used multiomics approaches and drug screens to identify the pan-HDAC inhibitor panobinostat as an effective strategy to limit MEK inhibitor
Juho Heliste et al.
BMC cardiovascular disorders, 18(1), 196-196 (2018-10-22)
Receptor tyrosine kinases (RTK) are potential targets for the treatment of ischemic heart disease. The human RTK family consists of 55 members, most of which have not yet been characterized for expression or activity in the ischemic heart. RTK gene
Claire Henry et al.
Oncotarget, 6(37), 40310-40326 (2015-10-31)
In recent years, the Wnt signalling pathway has been implicated in epithelial ovarian cancer and its members have potential as diagnostic, prognostic and therapeutic targets. Here we investigated the role of two Wnt receptor tyrosine kinases (RTKs), ROR1 and ROR2
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU047741-20UG | 04061828556281 |
| EHU047741-50UG | 04061828321056 |