Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
CGCACACATAGGCCATCTTATGAAGATAGAGTTTGTTTTGTAGCTACTGTCAGGTTAGCTACACCTCAGTTCATCAAGGAAATGTGCACTGTTGAAGAACCCAATGAAGAGTTTACATCTAGACATAGTTTAGAATGGAAGTTTCTGTTTCTAGATCACAGGGCACCACCCATAATAGGGTATTTGCCATTTGAAGTTCTGGGAACATCAGGCTATGATTACTATCATGTGGATGACCTAGAAAATTTGGCAAAATGTCATGAGCACTTAATGCAATATGGGAAAGGCAAATCATGTTATTATAGGTTCCTGACTAAGGGGCAACAGTGGATTTGGCTTCAGACTCATTATTATATCACTTACCATCAGTGGAATTCAAGGCCAGAGTTTATTGTTTGTACTCACACTGTAGTAAGTTATGCAGAAGTTAGGGCTGAAAGACGACG
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Soon Young Shin et al.
Scientific reports, 7(1), 11175-11175 (2017-09-13)
The juice of Ageratum houstonianum is used in folk medicine as an external wound healing aid for skin injuries. However, the active component of A. houstonianum and its mode of action in skin wound healing has not been investigated. This
Pan Jiang et al.
International journal of molecular medicine, 46(6), 2216-2224 (2020-10-31)
Circadian rhythm plays an important role in diverse physiological processes. Abnormal expression of circadian rhythm genes is associated with increased risk of disease, including different types of cancer. The cancer stem cell (CSC) hypothesis suggests that there is a small
Qixia Jiang et al.
Acta biochimica et biophysica Sinica, 50(9), 869-879 (2018-08-21)
To explore the association between clock circadian regulator circadian locomotor output cycles kaput gene (CLOCK) and the forming of atherosclerotic plaques and its underlying mechanisms, mouse aortic endothelial cells (MAECs) and atherosclerosis (AS) mouse model were recruited for our study.
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU056991-20UG | 04061828560011 |
| EHU056991-50UG | 04061828314133 |