Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
GACTCTGCTGCTGTTTGTGGGGCTGCTGCTGACCTGGGAGAGTGGGCAGGTCCTGGGGGACCAGACGGTCTCAGACAATGAGCTCCAGGAAATGTCCAATCAGGGAAGTAAGTACGTCAATAAGGAAATTCAAAATGCTGTCAACGGGGTGAAACAGATAAAGACTCTCATAGAAAAAACAAACGAAGAGCGCAAGACACTGCTCAGCAACCTAGAAGAAGCCAAGAAGAAGAAAGAGGATGCCCTAAATGAGACCAGGGAATCAGAGACAAAGCTGAAGGAGCTCCCAGGAGTGTGCAATGAGACCATGATGGCCCTCTGGGAAGAGTGTAAGCCCTGCCTGAAACAGACCTGCATGAAGTTCTACGCACGCGTCTGCAGAAGTGGCTCAGGCCTGGTTGGCCGCCAGCTTGAGGAGTTCCTGAACCAGAGCTCGCCCTTCTAC
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Clusterin contributes to hepatitis C virus-related hepatocellular carcinoma by regulating autophagy.
Na Fu et al.
Life sciences, 256, 117911-117911 (2020-06-07)
To explore the potential regulatory mechanism of differentially expressed mRNAs in Hepatitis C virus (HCV)-related hepatocellular carcinoma (HCC). Patients with HCV-related HCC and age- and gender-matched healthy subjects were enrolled. Differentially expressed mRNAs in the plasma were detected by digital
Jung-Yoon Heo et al.
The Journal of endocrinology, 237(2), 175-191 (2018-03-23)
Clusterin is a secretory glycoprotein that is involved in multiple physiopathological processes, including lipid metabolism. Previous studies have shown that clusterin prevents hepatic lipid accumulation via suppression of sterol regulatory element-binding protein (SREBP) 1. In this study, we examined the
Patricia M Schnepp et al.
Cancer research, 77(11), 2844-2856 (2017-04-13)
The impact of altered amino acid metabolism on cancer progression is not fully understood. We hypothesized that a metabolic transcriptome shift during metastatic evolution is crucial for brain metastasis. Here, we report a powerful impact in this setting caused by
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU058001-20UG | 04061828560455 |
| EHU058001-50UG | 04061828315116 |