Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
GAACTGGGGAAGATCATGGACAGGTTCGAAGAGGTTGTGTACCAGGCCATGGAGGAAGTTCAGAAGCAGAAGGAACTTTCCAAAGCTGAAATCCAGAAAGTTCTAAAAGAAAAAGACCAACTTACCACAGATCTGAACTCCATGGAGAAGTCCTTCTCCGACCTCTTCAAGCGTTTTGAGAAACAGAAAGAGGTGATCGAGGGCTACCGCAAGAACGAAGAGTCACTGAAGAAGTGCGTGGAGGATTACCTGGCAAGGATCACCCAGGAGGGCCAGAGGTACCAAGCCCTGAAGGCCCACGCGGAGGAGAAGCTGCAGCTGGCAAACGAGGAGATCGCCCAGGTCCGGAGCAAGGCCCAGGCGGAAGCGTTGGCCCTCCAGGCCAGCCTGAGGAAGGAGCAGATGCGCATCCAGTCGCTGGAGAAGACAGTGGAGCAGAAGACTAAAGAGAACGAGGAGCTGACCAGGATCTG
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Congran Zhao et al.
Oncology letters, 15(5), 6881-6886 (2018-05-05)
TACC3, a member of the transforming acidic coiled-coil protein (TACC) family, is a multifunctional protein that is involved in various biological functions, including proliferation and differentiation of tumor cells, cancer progression and metastasis. The aims of the present study were
Feng Guo et al.
Oncology research, 26(2), 183-189 (2017-01-22)
Transforming acidic coiled-coil protein 3 (TACC3) is a member of the TACC family and plays an important role in regulating cell mitosis, transcription, and tumorigenesis. However, the expression pattern and roles of TACC3 in renal cell carcinoma (RCC) remain unclear.
Colleen Furey et al.
Cell reports, 30(1), 269-283 (2020-01-09)
End-binding proteins (EBs) are widely viewed as master regulators of microtubule dynamics and function. Here, we show that while EB1 mediates the dynamic microtubule capture of herpes simplex virus type 1 (HSV-1) in fibroblasts, in neuronal cells, infection occurs independently
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU063201-20UG | 04061831351170 |
| EHU063201-50UG | 04061831372168 |