Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
ATCGATGGCCACATCTATGCCGTCGGCGGCTCCCACGGCTGCATCCACCACAACAGTGTGGAGAGGTATGAGCCAGAGCGGGATGAGTGGCACTTGGTGGCCCCAATGCTGACACGAAGGATCGGGGTGGGCGTGGCTGTCCTCAATCGTCTCCTTTATGCCGTGGGGGGCTTTGACGGGACAAACCGCCTTAATTCAGCTGAGTGTTACTACCCAGAGAGGAACGAGTGGCGAATGATCACAGCAATGAACACCATCCGAAGCGGGGCAGGCGTCTGCGTCCTGCACAACTGTATCTATGCTGCTGGGGGCTATGATGGTCAGGACCAGCTGAACAGCGTGGAGCGCTACGATGTGGAAACAGAGACGTGGACTTTCGTAGCCCCCATGAAGCACCGGCGAAGTGCCCTGGGGATCACTGTCCACCAGGGGAGAATCTACGTCCTTGGAGGCTATGATGGTCACA
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Jinqian Liang et al.
Cell death & disease, 10(12), 888-888 (2019-11-27)
Activation of nuclear-factor-E2-related factor 2 (Nrf2) cascade can alleviate dexamethasone (DEX)-induced oxidative injury and death of human osteoblasts. A recent study has shown that phosphoglycerate kinase 1 (PGK1) inhibition/depletion will lead to Kelch-like ECH-associated protein 1 (Keap1) methylglyoxal modification, thereby
Indira D Pokkunuri et al.
American journal of physiology. Renal physiology, 319(4), F686-F696 (2020-08-25)
Renal proximal tubular apoptosis plays a critical role in kidney health and disease. However, cellular molecules that trigger renal apoptosis remain elusive. Here, we evaluated the effect of inhibiting protein disulfide isomerase (PDI), a critical thioredoxin chaperone protein, on apoptosis
Weixia Sun et al.
Free radical biology & medicine, 108, 840-857 (2017-05-02)
Epigallocatechin gallate (EGCG) is the most abundant and effective green tea catechin and has been reported to attenuate diabetic nephropathy (DN). However, the mechanism by which EGCG ameliorates DN, till now, has remained unclear. EGCG is known as a potent
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU065431-50UG | 04061828383030 |
| EHU065431-20UG | 04061831351507 |