Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
GACCCAGAACGCTTCAGTTCTGCTCTGCAAGGATATATAATAACTGATTGGTGTGCCCGTTTAATAAAAGAATATGGAAACTGAACAGCCAGAAGAAACCTTCCCTAACACTGAAACCAATGGTGAATTTGGTAAACGCCCTGCAGAAGATATGGAAGAGGAACAAGCATTTAAAAGATCTAGAAACACTGATGAGATGGTTGAATTACGCATTCTGCTTCAGAGCAAGAATGCTGGGGCAGTGATTGGAAAAGGAGGCAAGAATATTAAGGCTCTCCGTACAGACTACAATGCCAGTGTTTCAGTCCCAGACAGCAGTGGCCCCGAGCGCATATTGAGTATCAGTGCTGATATTGAAACAATTGGAGAAATTCTGAAGAAAATCATCCCTACCTTGGAAGAGGGCCTGCAGTTGCCATCACCCACTGCAACCAGCCAGCTCCCGCTCGAATCTGATGCTGTGGA
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Agata Swiatkowska et al.
RNA biology, 17(10), 1402-1415 (2020-05-26)
The p53 protein is one of the transcription factors responsible for cell cycle regulation and prevention of cancer development. Its expression is regulated at the transcriptional, translational and post-translational levels. Recent years of research have shown that the 5' terminus
Xue Gong et al.
Oncotarget, 8(12), 18657-18669 (2017-04-21)
Clear cell renal cell carcinomas (ccRCC) show a broad range of clinical behavior, and prognostic biomarkers are needed to stratify patients for appropriate management. We sought to determine whether long intergenic non-coding RNAs (lincRNAs) might predict patient survival. Candidate prognostic
Taiyo Otoshi et al.
PloS one, 10(12), e0145769-e0145769 (2015-12-30)
Heterogeneous nuclear ribonucleoprotein (hnRNP) K is a part of the ribonucleoprotein complex which regulates diverse biological events. While overexpression of hnRNP K has been shown to be related to tumorigenesis in several cancers, both the expression patterns and biological mechanisms
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU065671-50UG | 04061831372366 |
| EHU065671-20UG | 04061831351545 |