Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
TGCAGTGGCTCTTGAAATTGGGGCTGACCTCCCATCTAATCATGTCATTGATCGCTGGCTTGGGGAGCCCATCAAAGCAGCCATTCTCCCCACTAGCATTTTCCTGACCAATAAGAAGGGATTTCCTGTTCTTTCTAAGATGCACCAGAGGCTCATCTTCCGGCTCCTCAAGTTGGAGGTGCAGTTCATCATCACAGGCACCAACCACCACTCAGAGAAGGAGTTCTGCTCCTACCTCCAATACCTGGAATACTTAAGCCAGAACCGTCCTCCACCTAATGCCTATGAACTCTTTGCCAAGGGCTATGAAGACTATCTGCAGTCCCCGCTTCAGCCACTGATGGACAATCTGGAATCTCAGACATATGAAGTGTTTGAAAAGGACCCCATCAAATACTCTCAGTACCAGCAGGCC
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... PRMT5(10419)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Biochem/physiol Actions
PRMTs (protein arginine N-methyltransferases) are responsible for the methylation of arginine residues in histones. PRMT5 causes monomethylation and symmetric dimethylation reactions. It works as an oncogene is some neoplasms and is associated with cell proliferation, inhibition of cell death and regulation of tumor suppressor genes. PRMT5 is also involved in stem cell maintenance by controlling differentiation-associated genes. It is involved in cellular responses, including neurogenesis and myogenesis metabolic events, somatic cell reprogramming, regulation of Golgi apparatus, ribosome biogenesis and neuronal spreading and movements.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Dongying Chen et al.
Journal of cellular and molecular medicine, 21(4), 781-790 (2016-11-20)
To probe the role of protein arginine methyltransferase 5 (PRMT5) in regulating inflammation, cell proliferation, migration and invasion of fibroblast-like synoviocytes (FLSs) from patients with rheumatoid arthritis (RA). FLSs were separated from synovial tissues (STs) from patients with RA and
Myc and Omomyc functionally associate with the Protein Arginine Methyltransferase 5 (PRMT5) in glioblastoma cells.
Mongiardi MP
Scientific Reports, 5, 15494-15494 (2015)
Nan Wang et al.
Cell death & disease, 11(10), 864-864 (2020-10-17)
Metastasis is the main cause of laryngeal cancer-related death; its molecular mechanism remains unknown. Here we identify protein arginine methyltransferase 5 (PRMT5) as a new metastasis-promoting factor in laryngeal carcinoma, and explore its underlying mechanism of action in regulating laryngeal
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU065921-20UG | 04061831351576 |
| EHU065921-50UG | 04061831372380 |