Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
AGGGCTGGTGTTAACTTACGACTTCACTAACTGTGACTTTGAGAAGATTAAAGCAGCCTATCTCAGTACTATTTCTAAAGACCTGATTACATATATGAGTGGGACCAAAAGTACCGAGTTCAACAACACCGTCTCTTGTAGCAATCGGCCACATTGCCTTACTGAAATCCAGAGCCTAACCTTCAATCCCACCGCCGGCTGCGCGTCGCTCGCCAAAGAAATGTTCGCCATGAAAACTAAGGCTGCCTTAGCTATCTGGTGCCCAGGCTATTCGGAAACTCAGATAAATGCTACTCAGGCAATGAAGAAGAGGAGAAAAAGGAAAGTCACAACCAATAAATGTCTGGAACAAGTGTCACAATTACAAGGATTGTGGCGTCGCTTCAATCGACCTTTACTGAAACAACAGTAAACCATCTTTATTATGGTCATATTTCACAGCACCA
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Chenyang Dai et al.
Experimental eye research, 182, 19-29 (2019-03-12)
Thymic stromal lymphopoietin (TSLP) is an interleukin 7 (IL-7)-like four helix bundle cytokine that plays diverse roles in the regulation of immune responses. In fungal infection, pattern recognition receptors (PRRs), including the cell surface Toll-like receptors (TLRs) and cytoplasmic NOD-like
Gaoshun Ni et al.
Cellular immunology, 312, 35-41 (2016-11-28)
The newly discovered intracytosolic pattern recognition receptor nucleotide-binding oligomerization domain 2 (NOD2) has been studied as an important indicator of T helper 2 (Th2) inflammation, and its effect on regulatory T (Treg) cells is likely to modulate the immune response.
Na-Ra Han et al.
Journal of clinical medicine, 8(9) (2019-09-05)
Thymic stromal lymphopoietin (TSLP) is crucial for Th2-mediated inflammation. Sepsis is a serious systemic inflammatory reaction with organ dysfunction by infection. However, the function of TSLP during sepsis is poorly understood. Thus, we investigated a role and regulatory mechanism of
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU075571-20UG | 04061828618057 |
| EHU075571-50UG | 04061831372991 |