Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
CGGCTCCTCAGAAGATTCCTTTGTTGAAATTAGGATGGCTGAAGGAGAAGCAGAAGGGTCAGTAAAAGAAATCAAGCATAGTCCTGGGCCCACGAGAACAGTCTCCACTGGCACGGCATTGTCTAAATATAGGAGCAGATCTGCAGATGGGGCCAAGAATTACTTCGAACATGAGGAGTTAACTGTGAGCCAGCTCCTGCTGTGCCTAAGGGAAGGGAATCAGAAGGTGGAGAGACTTGAAGTTGCACTCAAGGAGGCCAAAGAAAGAGTTTCAGATTTTGAAAAGAAAACAAGTAATCGTTCTGAGATTGAAACCCAGACAGAGGGGAGCACAGAGAAAGAGAATGATGAAGAGAAAGGCCCGGAGACTGTTGGAAGCGAAGTGGAAGCACTGAACCTCCAGGTG
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Kehong Chen et al.
FASEB journal : official publication of the Federation of American Societies for Experimental Biology, 33(3), 4571-4585 (2018-12-21)
Tubulointerstitial inflammation plays a critical role in the progression of diabetic nephropathy (DN), and nucleotide-binding oligomerization domain-like receptor family pyrin domain-containing 3 (NLRP3) inflammasomes contribute to renal interstitial inflammation in DN. Decreased expression of optineurin (OPTN) is also associated with
Astrid Skjesol et al.
PLoS pathogens, 15(3), e1007684-e1007684 (2019-03-19)
Phagocytosis is a complex process that eliminates microbes and is performed by specialised cells such as macrophages. Toll-like receptor 4 (TLR4) is expressed on the surface of macrophages and recognizes Gram-negative bacteria. Moreover, TLR4 has been suggested to play a
Defects in optineurin- and myosin VI-mediated cellular trafficking in amyotrophic lateral sclerosis.
Vinod Sundaramoorthy et al.
Human molecular genetics, 24(13), 3830-3846 (2015-04-11)
Amyotrophic lateral sclerosis (ALS) is a fatal neurodegenerative disorder primarily affecting motor neurons. Mutations in optineurin cause a small proportion of familial ALS cases, and wild-type (WT) optineurin is misfolded and forms inclusions in sporadic ALS patient motor neurons. However
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU077201-50UG | 04061831373134 |
| EHU077201-20UG | 04061828628421 |