Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
GGCCAGCAAAGTTGAGAAACTCACTTTAGACAATGCTGCTTTCCCTTTCCTTGCATATTCTGGAATCCCAGCAGTTTCTTTCTGTTTTTGCGAGGACACAGATTATCCTTATTTGGGTACCACCATGGACACCTATAAGGAACTGATTGAGAGGATTCCTGAGTTGAACAAAGTGGCACGAGCAGCTGCAGAGGTCGCTGGTCAGTTCGTGATTAAACTAACCCATGATGTTGAATTGAACCTGGACTATGAGAGGTACAACAGCCAACTGCTTTCATTTGTGAGGGATCTGAACCAATACAGAGCAGACATAAAGGAAATGGGCCTGAGTTTACAGTGGCTGTATTCTGCTCGTGGAGACTTCTTCCGTGCTACTTCCAGACTAACAACAGATTTCGGGAATGC
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Jason W Dang et al.
Cell reports, 27(12), 3618-3628 (2019-06-20)
Zika virus (ZIKV) infection is implicated in severe fetal developmental disorders, including microcephaly. MicroRNAs (miRNAs) post-transcriptionally regulate numerous processes associated with viral infection and neurodegeneration, but their contribution to ZIKV pathogenesis is unclear. We analyzed the mRNA and miRNA transcriptomes of human
Xinjian Lin et al.
Oncoscience, 1(3), 185-195 (2015-01-17)
The αV integrin is expressed in most cancer cells where it regulates a diverse array of cellular functions essential to the initiation, progression and metastasis of solid tumors. However, little is known about how αV integrin modulates cellular sensitivity to
Julie Mazzolini et al.
The Biological bulletin, 231(1), 40-60 (2016-09-18)
Particles present in diesel exhaust have been proposed as a significant contributor to the development of acute and chronic lung diseases, including respiratory infection and allergic asthma. Nanoceria (CeO2 nanoparticles) are used to increase fuel efficiency in internal combustion engines
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU078971-20UG | 04061831363272 |
| EHU078971-50UG | 04061831373257 |