Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
ATTCCCTCCTTGCTCGAGATGGATCTGCCCGTGGGCCCCGGCGCGGCGGGGCCCAGCAACGTCCCGGCCTTCCTGACCAAGCTGTGGACCCTCGTGAGCGACCCGGACACCGACGCGCTCATCTGCTGGAGCCCGAGCGGGAACAGCTTCCACGTGTTCGACCAGGGCCAGTTTGCCAAGGAGGTGCTGCCCAAGTACTTCAAGCACAACAACATGGCCAGCTTCGTGCGGCAGCTCAACATGTATGGCTTCCGGAAAGTGGTCCACATCGAGCAGGGCGGCCTGGTCAAGCCAGAGAGAGACGACACGGAGTTCCAGCACCCATGCTTCCTGCGTGGCCAGGAGCAGCTCCTTGAGAACATCAAGAGGAAAGTGACCAGTGTGTCCACCCTGAAGAGTGAAGACATAAAGATCCGCCAGGA
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
General description
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Seok Jun Kim et al.
Yonsei medical journal, 59(9), 1041-1048 (2018-10-18)
Heat shock factor 1 (HSF1) is a key regulator of the heat shock response and plays an important role in various cancers. However, the role of HSF1 in gastric cancer is still unknown. The present study evaluated the function of
Liang Chen et al.
Cell cycle (Georgetown, Tex.), 18(1), 60-68 (2018-12-20)
Cells mainly rely on stress proteins, such as heat-shock proteins (HSPs), to respond to various proteotoxic conditions. These proteins protect tumor cells and enhance their survive. However, the regulation of stress proteins involved in protein quality control (PQC) is still
Antonio Cigliano et al.
Oncotarget, 8(33), 54149-54159 (2017-09-15)
Upregulation of the heat shock transcription factor 1 (HSF1) has been described as a frequent event in many cancer types, but its oncogenic role in hepatocellular carcinoma (HCC) remains poorly delineated. In the present study, we assessed the function(s) of
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU107721-50UG | 04061828378357 |
| EHU107721-20UG | 04061831357820 |