Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
AGCTGGGCAGAAGGATTTTTGCACGAGAACATGGATCAAATAAGAAATTGGCAGCACAGTCCTGTGCCCTGTCACTTGTCAGACAACTGTACCATCTTGGAGTGGTTGAAGCTTACTCCGGACTTACAAAGAAGAAGGAAGGAGAGACAGTGGAGCCTTACAAAGTAAACCTCTCTCAAGATTTAGAGCATCAGCTGCAAAACATCATTCAAGAGCTAAATCTTGAGATTTTGCCCCCGCCTGAAGATCCTTCTGTGCCAGTTGCACTCAACATTGGCAAATTGGCTCAGTTCGAACCATCTCAGCGACAAAACCAAGTGGGTGTGGTTCCTTGGTCACCTCCACAATCCAACTGGAATCCTTGGACTAGTAGCAACATTGATGAGGGGCCTCTGGCTTTTGCTACTCC
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
General description
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
常规特殊物品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Wenmin Fu et al.
Journal of virology, 93(4) (2018-12-14)
Epstein-Barr virus (EBV) SM protein is an RNA-binding protein that has multiple posttranscriptional gene regulatory functions essential for EBV lytic replication. In this study, we identified an interaction between SM and DHX9, a DExH-box helicase family member, by mass spectrometry
Pratirodh Koirala et al.
Nature communications, 8, 14422-14422 (2017-02-09)
Despite the overwhelming number of human long non-coding RNAs (lncRNAs) reported so far, little is known about their physiological functions for the majority of them. The present study uses a CRISPR/Cas9-based synergistic activation mediator (SAM) system to identify potential lncRNAs
Jie Zhang et al.
Molecular medicine reports, 20(2), 1429-1435 (2019-06-08)
Pathological scarring is a result of the hypertrophy of scar tissue during tissue repair following trauma. The aim of the present study was to assess the effect of ubiquitin‑specific protease 4 (USP4) silencing on pathological scarring, and to evaluate the
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU109681-50UG | 04061831374681 |
| EHU109681-20UG | 04061831358124 |