Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
CCATGGCAGATTATGAAGCACGGATCTTTACTTTTGGGACATGGATATACTCAGTTAACAAGGAGCAGCTTGCAAGAGCTGGATTTTATGCTTTAGGTGAAGGTGATAAAGTAAAGTGCTTTCACTGTGGAGGAGGGCTAACTGATTGGAAGCCCAGTGAAGACCCTTGGGAACAACATGCTAAATGGTATCCAGGGTGCAAATATCTGTTAGAACAGAAGGGACAAGAATATATAAACAATATTCATTTAACTCATTCACTTGAGGAGTGTCTGGTAAGAACTACTGAGAAAACACCATCACTAACTAGAAGAATTGATGATACCATCTTCCAAAATCCTATGGTACAAGAAGCTATACGAATGGGGTTCAGTTTCAAGGACATTAAGAAAATAATGGAGGAAAAAATTCAGATATCTGGGAGCAACTATAAATCACTTGAGGTTCTGGTTGCA
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
General description
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Ke Ren et al.
Pathology oncology research : POR, 25(1), 341-348 (2017-11-11)
To find the exact downstream effector of Pim-2 pathway in prostate cancer cells, and to determine the means by which it affects prostate cancer. XIAP, Pim-2 and p-eIF4B expressions were detected in PCA and BPH tissues. Then the Pim-2 and
Rachel Coyle et al.
International journal of oncology, 55(1), 191-202 (2019-05-23)
Malignant rhabdoid tumour (MRT) is a rare, aggressive paediatric neoplasm, primarily diagnosed in those below the age of three. MRTs most commonly arise in the central nervous system and kidneys. A poor prognosis accompanies the MRT diagnosis, with a reported
Min Lu et al.
IUBMB life, 72(10), 2154-2166 (2020-08-17)
MicroRNA-134-5p (MiR-134-5p) has been proposed as a promising novel biomarker for the diagnosis of acute myocardial infarction (AMI). However, the biological role of miR-134-5p in ischemic cardiomyocytes has been little disclosed yet. Expression of miR-134-5p and X-linked inhibitor of apoptosis
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU111091-20UG | 04061831358339 |
| EHU111091-50UG | 04061831374766 |