Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
TATGGATCGGCTGTTGTCCTTAATGGTGTGTAACCATGAGAAAGTGGGACTTCAAATACGGACCAATGTTAAGGATCTGGTGGGTCTAGAATTGAGTCCTGCTCTGTATCCAATGCTATTTAACAAATTGAAGAATACCATCAGCAAGTTTTTTGACTCCCAAGGACAGGTTTTATTGACTGATACCAATACTCAATTTGTAGAACAAACCATAGCTATAATGAAGAACTTGCTAGATAATCATACTGAAGGCAGCTCTGAACATCTAGGGCAAGCTAGCATTGAAACAATGATGTTAAATCTGGTCAGGTATGTTCGTGTGCTTGGGAATATGGTCCATGCAATTCAAATAAAAACGAAACTGTGTCAATTAGTTGAAGTAATGATGGCAAGGAGAGATGACC
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
General description
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Dana Rabara et al.
Proceedings of the National Academy of Sciences of the United States of America, 116(44), 22122-22131 (2019-10-16)
KRAS mutations occur in ∼35% of colorectal cancers and promote tumor growth by constitutively activating the mitogen-activated protein kinase (MAPK) pathway. KRAS mutations at codons 12, 13, or 61 are thought to prevent GAP protein-stimulated GTP hydrolysis and render KRAS-mutated
K Mellert et al.
Scientific reports, 8(1), 6171-6171 (2018-04-20)
In Neurofibromatosis 1 (NF1) germ line loss of function mutations result in reduction of cellular neurofibromin content (NF1+/-, NF1 haploinsufficiency). The Ras-GAP neurofibromin is a very large cytoplasmic protein (2818 AA, 319 kDa) involved in the RAS-MAPK pathway. Aside from regulation
Ritsuko Harigai et al.
Scientific reports, 8(1), 6069-6069 (2018-04-19)
Neurofibromatosis type 1 (NF1) is caused by germline mutations in the NF1 gene and is characterized by café au lait spots and benign tumours known as neurofibromas. NF1 encodes the tumour suppressor protein neurofibromin, which negatively regulates the small GTPase
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU115021-20UG | 04061828615162 |
| EHU115021-50UG | 04061828379927 |