Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
GCTGGTGCAAAGGATGAGTTGCACATTGTTGAAGCAGAGGCAATGAATTACGAAGGCAGTCCAATTAAAGTAACACTGGCAACTTTGAAAATGTCTGTACAGCCAACGGTTTCCCTTGGGGGCTTTGAAATAACACCACCAGTGGTCTTAAGGTTGAAGTGTGGTTCAGGGCCAGTGCATATTAGTGGACAGCACTTAGTAGCTGTGGAGGAAGATGCAGAGTCAGAAGATGAAGAGGAGGAGGATGTGAAACTCTTAAGTATATCTGGAAAGCGGTCTGCCCCTGGAGGTGGTAGCAAGGTTCCACAGAAAAAAGTAAAACTTGCTGCTGATGAAGATGATGACGATGATGATGAAGAGGATGATGATGAAGATGATGATGATGATGATTTTGATGATGAGGAAGCTGAAGAAAAAGCGCCAGTGAAGAAA
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
General description
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
L Lam et al.
Oncogenesis, 1, e4-e4 (2012-01-01)
Nucleophosmin (NPM) is a nucleolar phosphoprotein that is involved in many cellular processes and has both oncogenic and growth suppressing activities. NPM is localized primarily in nucleoli but shuttles between the nucleus and the cytoplasm, and sustained cytoplasmic distribution contributes
Laura Arnoldo et al.
Scientific reports, 5, 8552-8552 (2015-02-26)
High Mobility Group A are non-histone nuclear proteins that regulate chromatin plasticity and accessibility, playing an important role both in physiology and pathology. Their activity is controlled by transcriptional, post-transcriptional, and post-translational mechanisms. In this study we provide evidence for
Derek Hang-Cheong Cheung et al.
Scientific reports, 7, 43650-43650 (2017-03-04)
Telomerase activation and telomere maintenance are critical for cellular immortalization and transformation. PIN2/TERF1-interacting telomerase inhibitor 1 (PinX1) is a telomerase regulator and the aberrant expression of PinX1 causes telomere shortening. Identifying PinX1-interacting proteins is important for understanding telomere maintenance. We
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU115611-50UG | 04061828328550 |
| EHU115611-20UG | 04061831345025 |