Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
AAGCCCAGAGCATCATTGACGCAAATGATACTTTGAAGGACTTGACGAAAGTAACATTGGGAGACAATGTGAAATACTACAATTTGGCCAGGATAAAGTGGGACCCCTCTGATCCTCAAATAATATCTGAAGGTCTTTATGCAATTGCTGTAGTTTTAAGTTTCTCTAGGATAGCTTATATTTTACCAGCAAATGAAAGCTTTGGACCTCTGCAGATATCACTTGGAAGAACAGTCAAAGACATCTTCAAGTTCATGGTCATATTCATTATGGTGTTTGTGGCCTTTATGATTGGAATGTTCAATCTCTACTCCTACTACATTGGTGCAAAACAAAATGAAGCCTTCACAACAGTTGAAGAGAGTTTTAAGACACTGTTCTGGGCTATATTTGGACTTTCTGAAGTGAAATCAGTGGTCATCA
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
General description
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Navin K Kapur et al.
Journal of the American Heart Association, 3(4) (2014-07-13)
Right ventricular (RV) failure is a major cause of mortality worldwide and is often a consequence of RV pressure overload (RVPO). Endoglin is a coreceptor for the profibrogenic cytokine, transforming growth factor beta 1 (TGF-β1). TGF-β1 signaling by the canonical
Liang Wen et al.
Scientific reports, 6, 23269-23269 (2016-03-25)
Hepatocellular carcinoma (HCC) is notoriously refractory to chemotherapy because of its tendency to develop multi-drug resistance (MDR), whose various underlying mechanisms make it difficult to target. The calcium signalling pathway is associated with many cellular biological activities, and is also
Hitesh Soni et al.
Scientific reports, 6, 29041-29041 (2016-07-08)
Glomerular mesangial cell (GMC) proliferation and death are involved in the pathogenesis of glomerular disorders. The mechanisms that control GMC survival are poorly understood, but may include signal transduction pathways that are modulated by changes in intracellular Ca(2+) ([Ca(2+)]i) concentration.
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU116361-20UG | 04061831345162 |
| EHU116361-50UG | 04061828305025 |