Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
AAGCTGCAGGAGGAGATTCAGTTGAAGGAAGAAGCAGAGAACAATTTGGCTGCCTTCCGAGCGGACGTGGATGCAGCTACTCTAGCTCGCATTGACCTGGAGCGCAGAATTGAATCTCTCAACGAGGAGATCGCGTTCCTTAAGAAAGTGCATGAAGAGGAGATCCGTGAGTTGCAGGCTCAGCTTCAGGAACAGCAGGTCCAGGTGGAGATGGACATGTCTAAGCCAGACCTCACTGCCGCCCTCAGGGACATCCGGGCTCAGTATGAGACCATCGCGGCTAAGAACATTTCTGAAGCTGAGGAGTGGTACAAGTCGAAGGTGTCAGACCTGACCCAGGCAGCCAACAAGAACAACGACGCCCTGCGCCAGGCCAAGCAGGAGATGATGGAATACCGACACCAGATCCAGTCCTACACCTGCGAGATTGACGCCCTGAAGGGCACTAACGATTCCCTGATGAGGC
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
General description
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Ji Hyun Kim et al.
Anatomy & cell biology, 49(1), 50-60 (2016-04-07)
Fetal development of the face involves a specific type of cornification in which keratinocytes provide a mass or plug to fill a cavity. The epithelial-mesenchymal interaction was likely to be different from that in the usual skin. We examined expression
Xiao-Mei Lao et al.
Oncology letters, 11(3), 2027-2034 (2016-03-22)
Inflammation and desmoplasia are frequently identified in the tumor microenvironment, and have been demonstrated to be effective modulators of malignant biological events. However, the mechanisms by which the inflammatory microenvironment and interstitial fibrosis interact with one another remain to be
Tomoyuki Ikeda et al.
Journal of cardiovascular pharmacology, 66(5), 487-496 (2015-08-08)
The effects of chronic blockade of vasopressin type 1a receptors (V1aR) and the additive effects of a type 2 receptor (V2R) antagonist on the treatment of hypertension-induced heart failure and renal injury remain to be unknown. In this study, Dahl
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU121191-20UG | 04061828581801 |
| EHU121191-50UG | 04061828347025 |