Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
TGCTGACCGTGGTTACTTCATCCAGCCCACTGTGTTTGGAGATGTGCAGGATGGCATGACCATCGCCAAGGAGGAGATCTTCGGGCCAGTGATGCAGATCCTGAAGTTCAAGACCATAGAGGAGGTTGTTGGGAGAGCCAACAATTCCACGTACGGGCTGGCCGCAGCTGTCTTCACAAAGGATTTGGACAAGGCCAATTACCTGTCCCAGGCCCTCCAGGCGGGCACTGTGTGGGTCAACTGCTATGATGTGTTTGGAGCCCAGTCACCCTTTGGTGGCTACAAGATGTCGGGGAGTGGCCGGGAGTTGGGCGAGTACGGGCTGCAGGCATACACTGAAGTGAAAACTGTCACAGTCAAAGTGCCTCAGAAGAACTCATAAGAATCATGCAAGCTTCCTCCCTCAGCCATTGATGGAAAG
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
General description
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Li Xue et al.
Biochemical and biophysical research communications, 512(2), 319-325 (2019-03-20)
Moderate alcohol consumption has been shown to reduce atherosclerosis-associated diseases. As shown in our earlier works, ethanol has a dose-dependent protective effects against endothelial cellular senescence by activating aldehyde dehydrogenase 2 (ALDH2) in vitro. However, whether ethanol administration possesses anti-atherosclerosis properties
Alcohol Dehydrogenase 5 Is a Source of Formate for De Novo Purine Biosynthesis in HepG2 Cells.
Sajin Bae et al.
The Journal of nutrition, 147(4), 499-505 (2017-02-24)
Govindasamy-Muralidharan Karthik et al.
Cancer letters, 367(1), 76-87 (2015-07-26)
Breast cancer cells with stem cell characteristics (CSC) are a distinct cell population with phenotypic similarities to mammary stem cells. CSCs are important drivers of tumorigenesis and the metastatic process. Tamoxifen is the most widely used hormonal therapy for estrogen
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU130461-50UG | 04061828457427 |
| EHU130461-20UG | 04061831363838 |