Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
GCTTAAGCTGGGTGAGATCGTGACCACCATTCCCACCATAGGCTTCAACGTGGAAACCGTGGAGTACAAGAACATCAGCTTCACTGTGTGGGACGTGGGTGGCCAGGACAAGATCCGGCCCCTGTGGCGCCACTACTTCCAGAACACACAAGGCCTGATCTTCGTGGTGGACAGCAATGACAGAGAGCGTGTGAACGAGGCCCGTGAGGAGCTCATGAGGATGCTGGCCGAGGACGAGCTCCGGGATGCTGTCCTCCTGGTGTTCGCCAACAAGCAGGACCTCCCCAACGCCATGAATGCGGCCGAGATCACAGACAAGCTGGGGCTGCACTCACTACGCCACAGGAACTGGTACATTCAGGCCACCTGCGCCACCAGCGGCGACGGGCTCTATGAAGGACTGGACTGGCTGTCCAATCAGCTCCGGAACCAGAAGTGAACGCGACCCCCCTCCCTCTCACTCCTCTTGCCCTCTGCTTTA
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
General description
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Nisha Bte Mohd Rafiq et al.
The Journal of cell biology, 216(1), 181-197 (2016-12-23)
Podosomes represent a class of integrin-mediated cell-matrix adhesions formed by migrating and matrix-degrading cells. We demonstrate that in macrophage-like THP1 cells and fibroblasts stimulated to produce podosomes, down-regulation of the G-protein ARF1 or the ARF1 guanine nucleotide exchange factor, ARNO
Tatsuyuki Matsudaira et al.
Journal of cell science, 128(16), 3131-3142 (2015-07-03)
The retrograde pathway is defined by the transport of proteins and lipids from the plasma membrane through endosomes to the Golgi complex, and is essential for a variety of cellular activities. Recycling endosomes are important sorting stations for some retrograde
Christin Münzberg et al.
Journal of cellular and molecular medicine, 19(5), 948-959 (2015-03-11)
Hypersecretion is the major symptom of functional neuroendocrine tumours. The mechanisms that contribute to this excessive secretion of hormones are still elusive. A key event in secretion is the exit of secretory products from the Golgi apparatus. ADP-ribosylation factor (Arf)
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU144411-20UG | 04061828650309 |
| EHU144411-50UG | 04061828424658 |