Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
GCAGTGCTCTTGGCTGTGCACGCCGCGGTGAGGCCGCTGGGCGCCGGGCCAGACGCCGAGGCACAGCTGCGGAGGCTGCAGCTGAGCGCGGACCCTGAGCGGCCTGGGCGCTTCCGGCTGGAGCTGCTGGGCGCGGGACCTGGGGCGGTTAATTTGGAGTGGCCCCTGGAGTCAGTTTCCTACACCATCCGAGGCCCCACCCAGCACGAGCTACAGCCTCCACCAGGAGGGCCTGGAACCCTCAGCCTGCACTTCCTCAACCCTCAGGAAGCTCAGCGGTGGGCAGTCCTAGTCCGAGGTGCC
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
General description
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Dhanya Krishnan et al.
Neurobiology of aging, 93, 131-141 (2020-03-14)
Defective immune cell-mediated clearance of amyloid-beta (Aβ) and Aβ-associated inflammatory activation of immune cells are key contributors in pathogenesis of Alzheimer's disease (AD). However, the underlying mechanisms remain elusive. Shank-associated RH domain-interacting protein (SHARPIN) is a critical regulator of inflammatory
Julia Zinngrebe et al.
The Journal of experimental medicine, 213(12), 2671-2689 (2016-11-05)
The linear ubiquitin chain assembly complex (LUBAC), consisting of SHANK-associated RH-domain-interacting protein (SHARPIN), heme-oxidized IRP2 ubiquitin ligase-1 (HOIL-1), and HOIL-1-interacting protein (HOIP), is a critical regulator of inflammation and immunity. This is highlighted by the fact that patients with perturbed
Emilia Peuhu et al.
The EMBO journal, 36(2), 165-182 (2016-12-16)
SHARPIN is a widely expressed multifunctional protein implicated in cancer, inflammation, linear ubiquitination and integrin activity inhibition; however, its contribution to epithelial homeostasis remains poorly understood. Here, we examined the role of SHARPIN in mammary gland development, a process strongly
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU152211-20UG | 04061831366679 |
| EHU152211-50UG | 04061831376296 |