Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
CTGTTGTTGCTGTGGCTGATAGCCCCCAGCAGGGCCTGCACCTGTGTCCCACCCCACCCACAGACGGCCTTCTGCAATTCCGACCTCGTCATCAGGGCCAAGTTCGTGGGGACACCAGAAGTCAACCAGACCACCTTATACCAGCGTTATGAGATCAAGATGACCAAGATGTATAAAGGGTTCCAAGCCTTAGGGGATGCCGCTGACATCCGGTTCGTCTACACCCCCGCCATGGAGAGTGTCTGCGGATACTTCCACAGGTCCCACAACCGCAGCGAGGAGTTTCTCATTGCTGGAAAACTGCAGGATGGACTCTTGCACATCACTACCTGCAGTTTTGTGGCTCCCTGGAACAGCCTGAGCTTAGCTCAGCGCCGGGGCTTCACCAAGACCTACACTGTTGGCTGTGAGGAATGCACAGTGTTTCCCTGTTTATCCATCCCCTGCAAAC
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... TIMP1(7076)
General description
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Omar M Omar et al.
Molecular carcinogenesis, 57(11), 1577-1587 (2018-07-24)
Tissue inhibitor matrix metalloproteinase-1 (TIMP1) is one of four identified members of the TIMP family. We evaluated the role of TIMP1 in gastric cancer using human and mouse tissues along with gastric organoids and in vitro cell models. Using quantitative
Fenglin Zhao et al.
International journal of molecular medicine, 44(5), 1609-1618 (2019-09-06)
Parastomal hernia (PH) is a common complication following stoma formation. Abnormal collagen synthesis has been suggested to be involved in PH. The aim of the present study is to explore the effect and mechanism of the collagen synthesis on PH.
Rosemarie Chirco D'Angelo et al.
Molecular cancer research : MCR, 12(9), 1324-1333 (2014-06-05)
Tissue inhibitor of metalloproteinase-1 (TIMP-1) regulates intracellular signaling networks for inhibition of apoptosis. Tetraspanin (CD63), a cell surface binding partner for TIMP-1, was previously shown to regulate integrin-mediated survival pathways in the human breast epithelial cell line MCF10A. In the
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU156431-20UG | 04061831367294 |
| EHU156431-50UG | 04061828418022 |