Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
TCCCGCTCCAAAGAGTACATATGAGTCAAATACCAAACAGCTATCATATGATGAGGTTGTAAATCAGTCTAGTCCAAGCAACTGTACTGTATACTGTGGAGGTGTTACTTCTGGGCTAACAGAACAACTAATGCGTCAGACTTTTTCACCATTTGGACAAATAATGGAAATTCGAGTCTTTCCAGATAAAGGATATTCATTTGTTCGGTTCAATTCCCATGAAAGTGCAGCACATGCAATTGTTTCTGTTAATGGTACTACCATTGAAGGTCATGTTGTGAAATGCTATTGGGGCAAAGAAACTCTTGATATGATAAATCCCGTGCAACAGCAGAATCAAATTGGATATCCCCAACCTTATGGCCAGTGGGGCCAGTGGTATGGAAATGCACAACAAATTGGCCAGTA
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
General description
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Xuefeng Yang et al.
Biochimie, 154, 119-126 (2018-08-26)
Gastric cancer (GC) is one of the most common malignancies as well as the third leading cause for cancer-related death. Molecular basis of GC are essential and critical for its therapeutic treatment, but still remain poorly understood. T-cell intracellular antigen-1
Jovan Nikolic et al.
PLoS pathogens, 12(10), e1005942-e1005942 (2016-10-18)
Stress granules (SGs) are membrane-less dynamic structures consisting of mRNA and protein aggregates that form rapidly in response to a wide range of environmental cellular stresses and viral infections. They act as storage sites for translationally silenced mRNAs under stress
Alice Pasini et al.
Biochimica et biophysica acta, 1861(5), 463-472 (2018-03-21)
Cyclooxygenase-2 (COX-2), with its main antifibrotic metabolite PGE2, is regarded as an antifibrotic gene. Repressed COX-2 expression and deficient PGE2 have been shown to contribute to the activation of lung fibroblasts and excessive deposition of collagen in pulmonary fibrosis. We
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU158111-50UG | 04061828419586 |
| EHU158111-20UG | 04061831367584 |