EMU000731
MISSION® esiRNA
targeting mouse Ywhaz
Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
GCCTGCTCTCTTGCAAAAACAGCTTTCGATGAAGCCATTGCTGAACTTGATACATTAAGTGAAGAGTCGTACAAAGACAGCACGCTAATAATGCAGTTACTGAGAGACAACTTAACATTGTGGACATCGGATACCCAAGGAGATGAAGCAGAAGCAGGAGAAGGAGGGGAAAATTAACCGGCCTTCCAACCTTTGTCTGCCTCATTCTAAAATTTACACAGTAGACCATTTGTCATCCATGCTGTCCCACAGATAGTTTTTTTGTTTACGATTTATGACAGGTTTATGTTACTTCTATTTGAATTTCTATATTTCCCATGTGGTTTTTATGTTTTAATATTAGGGGAGTAGAGCCAGTTAACTTTAGGGAGTTACTCATTTTCATCTTGAGGTGGCCAAT
Ensembl | mouse accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
mouse ... YWHAZ(22631), Ywhaz(22631)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
flash_point_f
Not applicable
flash_point_c
Not applicable
Storage Class
12 - Non Combustible Liquids
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Langyong Mao et al.
American journal of cancer research, 5(6), 1939-1953 (2015-08-14)
The deregulation of microRNAs has been demonstrated in various tumor processes. Here, we report that microRNA-544 (miR-544) is decreased in cervical cancer tissues compared with normal cervical tissues. To identify the mechanisms involved in miR-544 deregulation, we studied the regulation
Gareth E Lim et al.
Nature communications, 6, 7671-7671 (2015-07-30)
The proteins that coordinate complex adipogenic transcriptional networks are poorly understood. 14-3-3ζ is a molecular adaptor protein that regulates insulin signalling and transcription factor networks. Here we report that 14-3-3ζ-knockout mice are strikingly lean from birth with specific reductions in
Hillary E Mulvey et al.
BMC cancer, 15, 571-571 (2015-08-02)
Extracellular vesicles (EVs) are secreted from many cells, carrying cargoes including proteins and nucleic acids. Research has shown that EVs play a role in a variety of biological processes including immunity, bone formation and recently they have been implicated in
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EMU000731-20UG | 04061828658701 |
| EMU000731-50UG | 04061828432875 |