Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
GCTCTTTCTCTCCGAACTGCAAGTGCTACATGATATTTCCAGTTTGTTGTCTCGTCATAAGCATCTAGCCAAGGACCATTCACCCGACTTGTATTCATTGGAGCTGGCAGGTTTGGATGAACTTGGGAAGCGTTATGGGGAAGACTCTGAACAGTTCAGGGATGCTTCTAAGATCCTTGTTGATGCTCTCCAAAAGTTTGCAGATGACATGTACAGTCTCTATGGTGGGAACGCAGTGGTAGAGTTAGTGACTGTCAAATCATTCGACACATCCCTTGTGAGGAAGTCAAGGACCATCCTTGAGGCAAAACAAGAGAACACCCAAAGTCCTTATAACCTTGCATATAAGTATAATTTGGAGTATTCAGTGGTTTTCAACTTGGTACTGTGGATTATGATCGGCTTG
Ensembl | mouse accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
mouse ... ATP6AP2(70495), Atp6ap2(70495)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Wendy W Batenburg et al.
PloS one, 9(6), e100954-e100954 (2014-06-27)
Dysfunction of renin-angiotensin system (RAS) contributes to the pathogenesis of diabetic retinopathy (DR). Prorenin, the precursor of renin is highly elevated in ocular fluid of diabetic patients with proliferative retinopathy. Prorenin may exert local effects in the eye by binding
Joseph C K Leung et al.
Apoptosis : an international journal on programmed cell death, 20(7), 907-920 (2015-03-27)
Glomerulo-podocytic communication plays an important role in the podocytic injury in IgA nephropathy (IgAN). In this study, we examine the role of podocytic angiotensin II receptor subtype 1 (AT1R) and prorenin receptor (PRR) in podocytic apoptosis in IgAN. Polymeric IgA
Feng Y Liu et al.
Journal of the renin-angiotensin-aldosterone system : JRAAS, 15(2), 99-108 (2014-03-05)
Since the discovery of the (pro)renin receptor (PRR), it has been considered as a novel bioactive molecule of the renin-angiotensin system (RAS). The activation of PRR can elicit a series of angiotensin II (AngII)-independent effects. In this study, we investigated
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EMU003641-20UG | 04061831368147 |
| EMU003641-50UG | 04061828430086 |