EMU046421
MISSION® esiRNA
targeting mouse Traf6
Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
TTTCCCTGACGGTAAAGTGCCCAAATAAAGGCTGTTTGCAAAAGATGGAACTGAGACATCTCGAGGATCATCAAGTACATTGTGAATTTGCTCTAGTGAATTGTCCCCAGTGCCAACGTCCTTTCCAGAAGTGCCAGGTTAATACACACATTATTGAGGATTGTCCCAGGAGGCAGGTTTCTTGTGTAAACTGTGCTGTGTCCATGGCATATGAAGAGAAAGAGATCCATGATCAAAGCTGTCCTCTGGCAAATATCATCTGTGAATACTGTGGTACAATCCTCATCAGAGAACAGATGCCTAATCATTATGATCTGGACTGCCCAACAGCTCCAATCCCTTGCACATTCAGTGTTTTTGGCTGTCATGAAAAGATGCAGAGGAATCACTTGGCACGACACTTG
Ensembl | mouse accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
mouse ... TRAF6(22034), Traf6(22034)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Melinda E Varney et al.
The Journal of experimental medicine, 212(11), 1967-1985 (2015-10-16)
TRAF-interacting protein with forkhead-associated domain B (TIFAB) is a haploinsufficient gene in del(5q) myelodysplastic syndrome (MDS). Deletion of Tifab results in progressive bone marrow (BM) and blood defects, including skewed hematopoietic stem/progenitor cell (HSPC) proportions and altered myeloid differentiation. A
Frank Secreto et al.
Leukemia & lymphoma, 55(8), 1884-1892 (2013-11-12)
B-cell activating factor-receptor (BAFF-R) is the primary BAFF receptor that is responsible for promoting B-cell development and survival. Malignant B-cells exploit the BAFF/BAFF-R system, and high serum BAFF levels or genetic alterations in BAFF receptors have been found in B-cell
Domenico Somma et al.
Journal of immunology (Baltimore, Md. : 1950), 194(7), 3286-3294 (2015-02-25)
IL-17 is a proinflammatory cytokine that promotes the expression of different cytokines and chemokines via the induction of gene transcription and the posttranscriptional stabilization of mRNAs. In this study, we show that IL-17 increases the half-life of the Zc3h12a mRNA
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EMU046421-20UG | 04061831347449 |
| EMU046421-50UG | 04061828292271 |