Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
ATTGCCTGTTCAGCTTGCTTTGGCAAAGGCTCTCACTTCTTGGCTGATGTCCTGTGGCAGATTAACAAAACAGTAGTTGGAAATTTTGGTGAAGCAAGAATTCAAGAAGAGGAAGGTCGAAATGAAAGTTCCAGCAATGACATGGATTGTTTAACCTCAGTGTTAAGGATAACTGGTGTGACAGAAAAGGACCTGTCCCTGGAATATGACTGTCTGGCCCTGAACCTTCATGGCATGATAAGGCACACCATAAGACTGAGAAGGAAACAACCAAGTAAGGAGTGTCCCTCACACATTGCTTGAATAAATTGGCTGAATCAGCTGTGCACTGCATCCGTTTTCTCCGAGGACTGTGTGTTGTAGCTTGGTCCCAGGGAATCCATCATGATCAAGGGAATAGTTGGCCTG
Ensembl | mouse accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
mouse ... IL1RL1(17082), Il1rl1(17082)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Xi-Xiang Yu et al.
Digestive diseases and sciences, 60(5), 1265-1272 (2015-02-07)
As a pro-inflammatory cytokine, IL-33 has been demonstrated to play an important role in tumor progression. It is reported that IL-33 is highly expressed in the serum and tumor tissues of patients with gastric cancer. However, the function of IL-33
S Stojkovic et al.
Journal of thrombosis and haemostasis : JTH, 12(6), 948-957 (2014-04-08)
Urokinase-type plasminogen activator (u-PA) plays a pivotal role in extracellular proteolysis and is thought to be critically involved in the modulation of angiogenesis. Interleukin (IL)-33 is a member of the IL-1 cytokine family, which is thought to act as danger
Anne Marie Thompson et al.
American journal of physiology. Heart and circulatory physiology, 307(4), H533-H541 (2014-06-29)
Loss of vascular smooth muscle cell (VSMC) function is a hallmark of vascular disease. VSMCs become increasingly dysregulated, apoptotic, and senescent as we age. Sirtuin 1 (SirT1) is a deactylase that regulates substrates associated with stress mitigation, metabolism, and aging.
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EMU047141-20UG | 04061828508426 |
| EMU047141-50UG | 04061828283361 |