Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
CAGAAAGCAATCGCAACTCACCACAAGCGGGATCAGTATCTTCGAGTTCAGAAAGATATATTTGTTCTTAAGGATACAGAGGAAGCTCTTTTAATAAACCTTAGAGACAGCCAAGTCCTTCAGCATAAAGAGAATCTTGACTGGGATTGGAATCTGATTGGGACCATCCTTAAGTGGCCAAATGTAAATCTAAGAAACTATAAAGATGAGCAGTTGCACAGGTTTGTGCGCAGACTTCTTTACTTTTACAAGCCCAGCAGCAAACTGTACGCTAGTCTGGATCTGGACTTGGCCAAGTCCAAGCAGCTCACAGTTGTCGGTTGTCAGTTTACAGAATTTCTGCTCGAGTCTGAAGAGGATGGGCAAGGATACTTAGAAGATCTCGTGAAAGATATTGTTCAGTGGCTCAATGCTTCA
Ensembl | mouse accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
mouse ... RICTOR(78757), 4921505C17Rik(78757)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
12 - Non Combustible Liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Haiying Cheng et al.
Cancer discovery, 5(12), 1262-1270 (2015-09-16)
We identified amplification of RICTOR, a key component of the mTOR complex 2 (mTORC2), as the sole actionable genomic alteration in an 18-year-old never-smoker with lung adenocarcinoma. Amplification of RICTOR occurs in 13% of lung cancers (1,016 cases) in The
Maikel A Farhan et al.
PloS one, 10(8), e0135245-e0135245 (2015-08-22)
Tumor neovascularization is targeted by inhibition of vascular endothelial growth factor (VEGF) or the receptor to prevent tumor growth, but drug resistance to angiogenesis inhibition limits clinical efficacy. Inhibition of the phosphoinositide 3 kinase pathway intermediate, mammalian target of rapamycin
Chi-Hao Chang et al.
Oncotarget, 6(3), 1478-1489 (2015-01-19)
Urothelial carcinoma is the most common type of malignancy in long-term dialysis patients and kidney transplant recipients in Taiwan. mTORCs (mammalian target of rapamycin complexes) and EGF are important in urothelial carcinoma. To identify the regulation of mTORCs upon EGF
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EMU048461-20UG | 04061831347623 |
| EMU048461-50UG | 04061831369410 |