EMU062291
MISSION® esiRNA
targeting mouse Tmem131
Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
CAGTGGATATGCGTGTGAGGGATATGGTTTTAAAGTGGTTAACTGTCAAGAGTTTGCCCTGAGTGCCAACGCCTCCAGAGACATAGTCATATTGTTTACTCCAGATTTCACAGCCTCCAGAGTCATTCGGGAGCTGAAGTTTGTGACAAGCAGTGGCTCCGAGTTTGTGTTTGTGTTGAATGCCTCTCTTCCGTACCACATGCTAGCCGCCTGTGCAGAAGCCCTCCCTAGACCCAACTGGGAGCTCGCGCTCTACATCATCATCTCCGGGGTCATGAGTGCACTCTTTCTCCTGGTCATTGGAACAGCCTACTTGGAAGCTCAAGGGATTTGGGAGCCCTTCCGAAGGCGACTCTCCTTTGAAGCCTCAAACCCGCCCTTTGATGTTGGAAGGCCATTTGATCTC
Ensembl | mouse accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
mouse ... TMEM131(56030), Tmem131(56030)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Shigemi Kimura et al.
Scientific reports, 4, 5066-5066 (2014-06-12)
The ZHTc6-MyoD embryonic stem cell line expresses the myogenic transcriptional factor MyoD under the control of a tetracycline-inducible promoter. Following induction, most of the ZHTc6-MyoD cells differentiate to myotubes. However, a small fraction does not differentiate, instead forming colonies that
Nicholas E Hoffman et al.
Molecular biology of the cell, 25(6), 936-947 (2014-01-17)
Emerging findings suggest that two lineages of mitochondrial Ca(2+) uptake participate during active and resting states: 1) the major eukaryotic membrane potential-dependent mitochondrial Ca(2+) uniporter and 2) the evolutionarily conserved exchangers and solute carriers, which are also involved in ion
Yvonne Diener et al.
Scientific reports, 5, 17184-17184 (2015-11-26)
Modulation of gene expression is a useful tool to study the biology of haematopoietic stem and progenitor cells (HSPCs) and might also be instrumental to expand these cells for therapeutic approaches. Most of the studies so far have employed stable
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EMU062291-20UG | 04061828475254 |
| EMU062291-50UG | 04061828249503 |