EMU071911
MISSION® esiRNA
targeting mouse Ezr
Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
GTTTAAATTCCGGGCCAAGTTCTACCCCGAAGACGTGGCCGAGGAACTCATCCAGGACATCACACAGAAGCTCTTCTTCCTGCAAGTCAAGGACGGGATCCTCAGCGACGAGATCTACTGCCCCCCAGAGACAGCCGTGCTCCTGGGCTCCTATGCCGTTCAGGCCAAGTTCGGAGATTATAACAAGGAAATGCACAAGTCTGGGTACCTCAGCTCGGAGCGGCTGATCCCCCAGAGAGTCATGGACCAACACAAGCTCAGCAGGGACCAGTGGGAGGACCGGATCCAGGTGTGGCACGCGGAACACCGAGGGATGCTCAAGGACAGTGCTATGCTGGAATACCTGAAGATTGCCCAGGACCTGGAAATGTATGGGATCAACTATTTCGAGATCAAAAACAAGAAAGGAACAGACCTTTGGCTTGGAGTC
Ensembl | mouse accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
mouse ... EZR(22350), Ezr(22350)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
C Oneyama et al.
Oncogene, 35(4), 501-512 (2015-04-14)
c-Src is upregulated in various human cancers, suggesting its role in malignant progression. However, the molecular circuits of c-Src oncogenic signaling remain elusive. Here we show that Fer tyrosine kinase oligomer mediates and amplifies Src-induced tumor progression. Previously, we showed
N Ece Gungor-Ordueri et al.
Endocrinology, 155(10), 3981-3995 (2014-07-23)
During spermatogenesis, the transport of spermatids and the release of sperms at spermiation and the remodeling of the blood-testis barrier (BTB) in the seminiferous epithelium of rat testes require rapid reorganization of the actin-based cytoskeleton. However, the mechanism(s) and the
Rathangadhara Chakrapani Nammalwar et al.
Biochimica et biophysica acta, 1853(9), 2086-2094 (2015-01-03)
The cortical cytoskeleton constitutes an important subcellular structure that determines cell shape and regulates cell migration as well as membrane traffic to and from the plasma membrane. Many components of the cortical cytoskeleton have been identified including structural and scaffolding
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EMU071911-20UG | 04061828481231 |
| EMU071911-50UG | 04061828255887 |