Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
TACACAGCACCAGTCCAAGCCTGTCACCATCACTGTCCAAGATCCAGCAACTACATCCTCCATCTCTCTAGTCTGGTACCACACTGCTTTCTCCCTAGTGATGTGCCTCCTGTTTGCAGTGGACACGGGCCTTTATTTCTACGTACGGAGAAATCTTCAAACCCCGAGGGAGTACTGGAGGAAGTCCCTGTCAATCAGAAAGCACCAGGCTCCTCAAGACAAGTGACACCCCATCCATCCTATGGCAAAACATACGATGTTTTGGTGGCAGCAGCAACTTTTCAGCCACACAGCCTTCCTTTGAAAGCAACTTACAAGCAGGCCGGGATGTTTGGTTCTTCAATCACAACGACTTAGGATCACCAGTTCAAGGCTTGCTGGGTCACACAGAGAGAGTGAGTGCAAGTCTAGCCTGGATAACCCAGTGAGATCCTGGG
Ensembl | mouse accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
mouse ... Fcgr3(14131)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Martina Schmittnaegel et al.
Cancer immunology research, 3(7), 764-776 (2015-02-19)
Tumor cells escape immune eradication through multiple mechanisms, including loss of antigenicity and local suppression of effector lymphocytes. To counteract these obstacles, we aimed to direct the unique cytomegalovirus (CMV)-specific immune surveillance against tumor cells. We developed a novel generation
Siva K Gandhapudi et al.
Journal of immunology (Baltimore, Md. : 1950), 194(8), 3820-3828 (2015-03-18)
Although IL-18 has not previously been shown to promote T lymphopoiesis, results obtained via a novel data mining algorithm (global microarray meta-analysis) led us to explore a predicted role for this cytokine in T cell development. IL-18 is a member
Wai W Lin et al.
Science signaling, 8(392), ra88-ra88 (2015-09-04)
Tumor necrosis factor receptor-associated factor 3 (TRAF3) is an adaptor protein that inhibits signaling by CD40 and by the receptor for B cell-activating factor (BAFF) and negatively regulates homeostatic B cell survival. Loss-of-function mutations in TRAF3 are associated with human
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EMU073651-20UG | 04061828538829 |
| EMU073651-50UG | 04061828306695 |