Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
TACCATGAATGGAACCAGCAACAGCCCCAGTGCTAACCACCAATCTTCCTTTGCCAGTAGACCTCGAAAATCATCACTAAATGGGTCATCAGCAACTTCATCTGGTTAGGACTGTTAAGGAAAAGATTTTTCAACCCCCTGATTTAGTTACCTTCATTCATTACAGCTTTATAGATGCTTAATACATGTGACTGTCGTCCAGTTTGCTTCCTTTTGTAGTGACTTTAAATTTGGCCATAAATGATGGACTAGATGTGATACTTCATATGGATGTTAAGTGGAAAGATTGATTCTTTCTCTAAAGAATTGGATTCTGAGAAGGATTCTGTGTTAGGAAAGATGTGAAATGATTTCTGTGACCACTGTTTGGATCTGGAAATGTTCTACAGTGGGTAGACATTGGGC
Ensembl | mouse accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
mouse ... BMI1(12151), Bmi1(12151)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Dan Xiong et al.
Cancer biology & therapy, 16(5), 756-763 (2015-04-17)
Previous studies indicate that the role of B lymphoma Mo-MLV insertion region 1 homolog (Bmi-1) is responsible for multiple cancer progression. However, Bmi-1 in controlling gene expression in non-small cell lung cancer (NSCLC) development is not well explored. Here we
Boyang Chang et al.
Biochimica et biophysica acta, 1840(12), 3285-3291 (2014-08-26)
Bmi-1 had been found to involve in self renewal of stem cells and tumorigenesis in various malignancies. In this study, we investigated the role of Bmi-1 in the development of salivary adenoid cystic carcinoma (SACC). At first, we confirmed that
Lei Liu et al.
International journal of clinical and experimental pathology, 8(6), 6674-6682 (2015-08-12)
The aim of this study was to evaluate the efficiency of a targeted siRNA nano-delivery system to silence the expression of Bmi-1 and hTERT, and to verify the toxicity of this delivery system in MCF-7 breast cancer cells. The most
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EMU093981-50UG | 04061831401462 |
| EMU093981-20UG | 04061831349566 |