Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
TCAACTAAACATGGGCAAAGGAGATCCTAAAAAGCCGAGAGGCAAAATGTCCTCATATGCATTCTTTGTGCAAACTTGCCGGGAGGAGCACAAGAAGAAGCACCCGGATGCTTCTGTCAACTTCTCAGAGTTCTCCAAGAAGTGCTCAGAGAGGTGGAAGACCATGTCTGCTAAAGAAAAGGGGAAATTTGAAGATATGGCAAAGGCTGACAAGGCTCGTTATGAAAGAGAAATGAAAACCTACATCCCCCCCAAAGGGGAGACCAAAAAGAAGTTCAAGGACCCCA
Ensembl | mouse accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
mouse ... HMGB1(100862258), Hmgb1(15289)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Regulatory Information
新产品
This item has
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Role of high-mobility group box 1 in methamphetamine-induced activation and migration of astrocytes.
Yuan Zhang et al.
Journal of neuroinflammation, 12, 156-156 (2015-09-05)
Mounting evidence has indicated that high-mobility group box 1 (HMGB1) is involved in cell activation and migration. Our previous study demonstrated that methamphetamine mediates activation of astrocytes via sigma-1 receptor (σ-1R). However, the elements downstream of σ-1R in this process
Yan Chen et al.
International journal of clinical and experimental pathology, 8(6), 6683-6691 (2015-08-12)
Diabetic nephropathy (DN) is one of the most devastating complications of diabetes, leading the cause of end-stage renal disease (ESRD). And investigations into mechanisms underlying renal inflammation may provide new insight into novel therapeutic targets for patients with DN. However
Zhe Liu et al.
Chinese journal of cancer research = Chung-kuo yen cheng yen chiu, 27(3), 267-278 (2015-07-15)
The purpose of this study was to examine the effect of gemcitabine (GEM) on microRNA-218 (miR-218) expression in human pancreatic cancer cells. Quantitative reverse transcription polymerase chain reaction (qRT-PCR) was performed to examine the differences in miR-218 expression between the
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EMU210181-20UG | 04061831392463 |
| EMU210181-50UG | 04061828726394 |